DNA digital data storage stores digital data as a DNA sequence. It leads to more compact storage because of the data density of DNA.
DNA File Storage |
Code
With the nucleic acid sequence there is a sequence of letters that indicate the order of nucleotides within a DNA. These are 'G', 'A', 'C', and 'T'. The DNA sequence, from the program above, for "Big Data" gives:
TGTCGCGCTACAGTGTGCTGCAGTACTCTGACATCGAGATACG TACGTACGTACGTACGTACGTACGTACGAGAG
Outline
DNA storage stores digital data in the form of a DNA base sequence. It leads to much denser storage of data. Some say that it could be used to store data which could be recovered in a disaster situation, and where future generations will be able to read the archived DNA sequences. It is, though, slow, as there is DNA sequencing involved for large amounts of data.
It was proposed by Mikhail Neiman in 1964, who stored on a device named MNeimON (Mikhail Neiman OligoNucleotides). Since then George Church at Harvard University, in 2012, estimated the could store 5.5 petabits on a cubic millimeter of DNA. In 2013, the EBI (European Bioinformatics Institute) stored five millions bits, including text and audio files, on a speck of dust. It included all of Shakespeare's sonnets, and the audio from Martin Luther King’s famous speak (“I Have a Dream”). It advanced research by encoding a strong error correction method using overlapping short oligonucleotides, and where the sequences were repeated four times (with two of them written backwards).
In order to improve the robustness of the storage, researchers have recently added the Reed-Solomon error correction code, which is used on CD-ROMs to correct errors. With this the researchers predicted the DNA could be encapsulated in silica glass spheres and could be preserved for one million years for -18°C. The current cost for the storage was quoted at $500/MB.